Review




Structured Review

Human Protein Atlas ptgds
Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. <t>(F)</t> <t>PTGDS-specific</t> expression in the single-cell atlas of the normal human lung as reported by Kyle et al.
Ptgds, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pmc12936275-72-9-4?v=Human+Protein+Atlas
Average 86 stars, based on 1 article reviews
ptgds - by Bioz Stars, 2026-07
86/100 stars

Images

1) Product Images from "PTGDS is a potential marker for lung adenocarcinoma identified in a pancancer analysis"

Article Title: PTGDS is a potential marker for lung adenocarcinoma identified in a pancancer analysis

Journal: Scientific Reports

doi: 10.1038/s41598-026-38688-0

Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. (F) PTGDS-specific expression in the single-cell atlas of the normal human lung as reported by Kyle et al.
Figure Legend Snippet: Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. (F) PTGDS-specific expression in the single-cell atlas of the normal human lung as reported by Kyle et al.

Techniques Used: Single Cell, Expressing, Functional Assay, Marker



Similar Products

94
OriGene tcgcctccaactcaagctggtt reverse
Tcgcctccaactcaagctggtt Reverse, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm42234557-282-97-100?v=OriGene
Average 94 stars, based on 1 article reviews
tcgcctccaactcaagctggtt reverse - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

86
Vigene Biosciences ptgds overexpression plasmid
Ptgds Overexpression Plasmid, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41933673-76-2-6?v=Vigene+Biosciences
Average 86 stars, based on 1 article reviews
ptgds overexpression plasmid - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

86
Vigene Biosciences oe ptgds plasmid
Oe Ptgds Plasmid, supplied by Vigene Biosciences, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41933673-63-12-15?v=Vigene+Biosciences
Average 86 stars, based on 1 article reviews
oe ptgds plasmid - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Proteintech antibodies ptgds
Antibodies Ptgds, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41866775-117-16-18?v=Proteintech
Average 93 stars, based on 1 article reviews
antibodies ptgds - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

93
Proteintech anti ptgds
Anti Ptgds, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41673763-117-31-34?v=Proteintech
Average 93 stars, based on 1 article reviews
anti ptgds - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

86
Human Protein Atlas ptgds
Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. <t>(F)</t> <t>PTGDS-specific</t> expression in the single-cell atlas of the normal human lung as reported by Kyle et al.
Ptgds, supplied by Human Protein Atlas, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pmc12936275-72-9-4?v=Human+Protein+Atlas
Average 86 stars, based on 1 article reviews
ptgds - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

93
Proteintech ptgds
Prediction of drugs and molecular docking. ( A ) The top 10 candidate drugs were predicted for hub genes using CMAP database. ( B – E ) Todralazine docking <t>to</t> <t>NPC2</t> (PDB 5KWY), <t>PTGDS</t> (3O22), RCAN1 (6UUQ), and SGPL1 (8AYF) using CB-Dock2. Reported Vina scores indicate favorable binding (<−5).
Ptgds, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pmc12764302-81-19-20?v=Proteintech
Average 93 stars, based on 1 article reviews
ptgds - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

91
Thermo Fisher gene exp ptgds hs00168748 m1
Prediction of drugs and molecular docking. ( A ) The top 10 candidate drugs were predicted for hub genes using CMAP database. ( B – E ) Todralazine docking <t>to</t> <t>NPC2</t> (PDB 5KWY), <t>PTGDS</t> (3O22), RCAN1 (6UUQ), and SGPL1 (8AYF) using CB-Dock2. Reported Vina scores indicate favorable binding (<−5).
Gene Exp Ptgds Hs00168748 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41386368-101-28-7?v=Thermo+Fisher
Average 91 stars, based on 1 article reviews
gene exp ptgds hs00168748 m1 - by Bioz Stars, 2026-07
91/100 stars
  Buy from Supplier

93
Proteintech l pgds antibody
Prediction of drugs and molecular docking. ( A ) The top 10 candidate drugs were predicted for hub genes using CMAP database. ( B – E ) Todralazine docking <t>to</t> <t>NPC2</t> (PDB 5KWY), <t>PTGDS</t> (3O22), RCAN1 (6UUQ), and SGPL1 (8AYF) using CB-Dock2. Reported Vina scores indicate favorable binding (<−5).
L Pgds Antibody, supplied by Proteintech, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ptgds/pm41386368-106-19-21?v=Proteintech
Average 93 stars, based on 1 article reviews
l pgds antibody - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

Image Search Results


Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. (F) PTGDS-specific expression in the single-cell atlas of the normal human lung as reported by Kyle et al.

Journal: Scientific Reports

Article Title: PTGDS is a potential marker for lung adenocarcinoma identified in a pancancer analysis

doi: 10.1038/s41598-026-38688-0

Figure Lengend Snippet: Single-cell data analysis of PTGDS expression and biological functions. (A) Correlation of PTGDS expression with functional status across 12 cancers according to the pancancer analysis. (B) Positive correlation between PTGDS expression and angiogenesis and differentiation in lung adenocarcinoma (LUAD). (C) PTGDS expression in the single-cell atlas of the normal human lung from the HPA database. (D) Relationships between PTGDS expression and the expression of various cell marker genes. (E) Single-cell atlas of the normal human lung. (F) PTGDS-specific expression in the single-cell atlas of the normal human lung as reported by Kyle et al.

Article Snippet: Additionally, data from the Human Protein Atlas (HPA) revealed PTGDS-specific expression in normal immune cells, notably in plasmacytoid dendritic cells and natural killer cells (Fig. E–G).

Techniques: Single Cell, Expressing, Functional Assay, Marker

Prediction of drugs and molecular docking. ( A ) The top 10 candidate drugs were predicted for hub genes using CMAP database. ( B – E ) Todralazine docking to NPC2 (PDB 5KWY), PTGDS (3O22), RCAN1 (6UUQ), and SGPL1 (8AYF) using CB-Dock2. Reported Vina scores indicate favorable binding (<−5).

Journal: Journal of Inflammation Research

Article Title: Integrative Machine Learning Analysis of Programmed Cell Death Pathways Identifies Novel Diagnostic Biomarkers for Atrial Fibrillation

doi: 10.2147/JIR.S568171

Figure Lengend Snippet: Prediction of drugs and molecular docking. ( A ) The top 10 candidate drugs were predicted for hub genes using CMAP database. ( B – E ) Todralazine docking to NPC2 (PDB 5KWY), PTGDS (3O22), RCAN1 (6UUQ), and SGPL1 (8AYF) using CB-Dock2. Reported Vina scores indicate favorable binding (<−5).

Article Snippet: Membranes were blocked with 5% non-fat milk (TBST, 1 h, 20–25 °C), incubated with primary antibodies against NPC2 and PTGDS (Proteintech, Wuhan, China) and against RCAN1 and SGPL1 (Cell Signaling Technology, MA, USA) overnight (4 °C), washed, and probed with HRP-conjugated secondaries (1 h, 20–25 °C).

Techniques: Binding Assay

Experimental validation in HL-1 cells and human PBMCs. qRT-PCR analysis of NPC2 ( A ), RCAN1 ( B ), SGPL1 ( C ) and PTGDS ( D ) expression in AF cell models; qRT-PCR analysis of NPC2 ( E ) and SGPL1 ( F ) in PBMCs from AF patients and healthy controls. ( G ) Western blot analysis of NPC2, RCAN1, SGPL1 and PTGDS expression in AF cell models. * P <0.05; ** P <0.01.

Journal: Journal of Inflammation Research

Article Title: Integrative Machine Learning Analysis of Programmed Cell Death Pathways Identifies Novel Diagnostic Biomarkers for Atrial Fibrillation

doi: 10.2147/JIR.S568171

Figure Lengend Snippet: Experimental validation in HL-1 cells and human PBMCs. qRT-PCR analysis of NPC2 ( A ), RCAN1 ( B ), SGPL1 ( C ) and PTGDS ( D ) expression in AF cell models; qRT-PCR analysis of NPC2 ( E ) and SGPL1 ( F ) in PBMCs from AF patients and healthy controls. ( G ) Western blot analysis of NPC2, RCAN1, SGPL1 and PTGDS expression in AF cell models. * P <0.05; ** P <0.01.

Article Snippet: Membranes were blocked with 5% non-fat milk (TBST, 1 h, 20–25 °C), incubated with primary antibodies against NPC2 and PTGDS (Proteintech, Wuhan, China) and against RCAN1 and SGPL1 (Cell Signaling Technology, MA, USA) overnight (4 °C), washed, and probed with HRP-conjugated secondaries (1 h, 20–25 °C).

Techniques: Biomarker Discovery, Quantitative RT-PCR, Expressing, Western Blot